s pneumoniae strain tigr4 (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC s pneumoniae strain tigr4
S Pneumoniae Strain Tigr4, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/s+pneumoniae+tigr4+genomic+dna/Genomic+DNA+from+Streptococcus+pneumoniae+strain+TIGR4/pm26411293-45-1-21
Average 99 stars, based on 62 article reviews

s pneumoniae strain tigr4 - by Bioz Stars, 2026-10

99/100 stars

Images

Amplification:

Article Title: Structure of the fucose mutarotase from Streptococcus pneumoniae in complex with l --fucose
Article Snippet: .. The fcsU gene (SP_2165) was amplified from S. pneumoniae TIGR4 genomic DNA (American Type Culture Collection BAA-334D) using primers FcsU-Fwd (GGCAGCCATAGTAAAACATATACCGAAA) and FcsU-Rev (GTGGTGCTCGAGTTATTGAACATTTTCTCTTTC) with engineered Nde I and Xho I restriction sites, respectively. ..

Article Title: Structural and functional analysis of fucose-processing enzymes from Streptococcus pneumoniae.
Article Snippet: Fucose metabolism pathways are present in many bacterial species and typically contain the central fucose-processing enzymes fucose isomerase (FcsI), fuculose kinase (FcsK), and fuculose-1-phosphate aldolase (FcsA).. Fucose initially undergoes isomerization by FcsI producing fuculose, which is then phosphorylated by FcsK.. FcsA cleaves the fuculose-1-phosphate product into lactaldehyde and dihydroxyacetone phosphate, which can be incorporated into central metabolism allowing the bacterium to use fucose as an energy source.

Article Title: Inhibition of the pneumococcal virulence factor StrH and molecular insights into N-glycan recognition and hydrolysis.
Article Snippet: .. Gene fragments encoding both GH20A and B modules (GH20A/B, amino acids 181-984) and the individual GH20 catalytic modules (GH20A, residues 181-614; GH20B, residues 627-1039) were amplified by PCR from S. pneumoniae TIGR4 genomic DNA (American Type Culture Collection BAA-334D) using specific primers to introduce a 50 NdeI and 30 XhoI restriction sites (see Table S1 available online for oligonucleotide primer sequences). ..

Article Title: Conformational analysis of StrH, the surface-attached exo-β-D-N-acetylglucosaminidase from Streptococcus pneumoniae.
Article Snippet: Streptococcus pneumoniae is a serious human pathogen that presents on its surface numerous proteins involved in the host–bacterium interaction.. The carbohydrate-active enzymes are particularly well represented among these surface proteins, and many of these are known virulence factors, highlighting the importance of carbohydrate processing by this pathogen.. StrH is a surface-attached exo-β-D-N-acetylglucosaminidase that cooperates with the sialidase NanA and the β-galactosidase BgaA to sequentially degrade the nonreducing terminal arms of complex N-linked glycans.

Article Title: Structure of the fucose mutarotase from Streptococcus pneumoniae in complex with l --fucose
Article Snippet: .. Expression and purification The fcsU gene (SP_2165) was amplified from S. pneumoniae TIGR4 genomic DNA (American Type Culture Collection BAA-334D) using primers FcsU-Fwd (GGCAGCCATAGTAAAACATATACCGAAA) and FcsU-Rev (GTGGTGCTCGAGTTATTGAACATTTTCTCTTTC) with engineered Nde I and Xho I restriction sites, respectively. ..

Article Title: Analysis of a New Family of Widely Distributed Metal-independent ?-Mannosidases Provides Unique Insight into the Processing of N -Linked Glycans
Article Snippet: .. The full-length spgh125 gene (locus tag SP_2144) was PCR amplified from S. pneumoniae TIGR4 genomic DNA (ATCC BAA-334D) using the following forward and reverse oligonucleotide primers, 5′-GGC AGC CAT ATG ATG GTT TAT TCG AAA G-3′ and 5′-GTG GTG CTC GAG TTA GCG AAT ATC CAA GTA ATC C-3′, respectively. .. The full-length cpgh125 gene (locus tag CPE0426) was PCR amplified from C. perfringens ATCC 13124 genomic DNA using the following forward and reverse oligonucleotide primers, 5′-TAT ACC ATG GCC AGT TTA TCA ACT AAC GAA TT-3′ and 5′-GTG GTG CTC GAG TTT TTT ATT TAT AAC TTT CTC-3′, respectively.

Article Title: Analysis of a New Family of Widely Distributed Metal-independent ?-Mannosidases Provides Unique Insight into the Processing of N -Linked Glycans
Article Snippet: .. Cloning, Production, and Purification of GH125 The full-length spgh125 gene (locus tag SP_2144) was PCR amplified from S. pneumoniae TIGR4 genomic DNA (ATCC BAA-334D) using the following forward and reverse oligonucleotide primers, 5′-GGC AGC CAT ATG ATG GTT TAT TCG AAA G-3′ and 5′-GTG GTG CTC GAG TTA GCG AAT ATC CAA GTA ATC C-3′, respectively. .. The full-length cpgh125 gene (locus tag CPE0426) was PCR amplified from C. perfringens ATCC 13124 genomic DNA using the following forward and reverse oligonucleotide primers, 5′-TAT ACC ATG GCC AGT TTA TCA ACT AAC GAA TT-3′ and 5′-GTG GTG CTC GAG TTT TTT ATT TAT AAC TTT CTC-3′, respectively.

Polymerase Chain Reaction:

Article Title: Analysis of a New Family of Widely Distributed Metal-independent ?-Mannosidases Provides Unique Insight into the Processing of N -Linked Glycans
Article Snippet: .. Cloning, Production, and Purification of GH125 The full-length spgh125 gene (locus tag SP_2144) was PCR amplified from S. pneumoniae TIGR4 genomic DNA (ATCC BAA-334D) using the following forward and reverse oligonucleotide primers, 5′-GGC AGC CAT ATG ATG GTT TAT TCG AAA G-3′ and 5′-GTG GTG CTC GAG TTA GCG AAT ATC CAA GTA ATC C-3′, respectively. .. The full-length cpgh125 gene (locus tag CPE0426) was PCR amplified from C. perfringens ATCC 13124 genomic DNA using the following forward and reverse oligonucleotide primers, 5′-TAT ACC ATG GCC AGT TTA TCA ACT AAC GAA TT-3′ and 5′-GTG GTG CTC GAG TTT TTT ATT TAT AAC TTT CTC-3′, respectively.

Introduce:

Expressing:

Purification:

Article Title: Analysis of a New Family of Widely Distributed Metal-independent ?-Mannosidases Provides Unique Insight into the Processing of N -Linked Glycans
Article Snippet: .. Cloning, Production, and Purification of GH125 The full-length spgh125 gene (locus tag SP_2144) was PCR amplified from S. pneumoniae TIGR4 genomic DNA (ATCC BAA-334D) using the following forward and reverse oligonucleotide primers, 5′-GGC AGC CAT ATG ATG GTT TAT TCG AAA G-3′ and 5′-GTG GTG CTC GAG TTA GCG AAT ATC CAA GTA ATC C-3′, respectively. .. The full-length cpgh125 gene (locus tag CPE0426) was PCR amplified from C. perfringens ATCC 13124 genomic DNA using the following forward and reverse oligonucleotide primers, 5′-TAT ACC ATG GCC AGT TTA TCA ACT AAC GAA TT-3′ and 5′-GTG GTG CTC GAG TTT TTT ATT TAT AAC TTT CTC-3′, respectively.

Cloning:

Article Title: Analysis of a New Family of Widely Distributed Metal-independent ?-Mannosidases Provides Unique Insight into the Processing of N -Linked Glycans
Article Snippet: .. Cloning, Production, and Purification of GH125 The full-length spgh125 gene (locus tag SP_2144) was PCR amplified from S. pneumoniae TIGR4 genomic DNA (ATCC BAA-334D) using the following forward and reverse oligonucleotide primers, 5′-GGC AGC CAT ATG ATG GTT TAT TCG AAA G-3′ and 5′-GTG GTG CTC GAG TTA GCG AAT ATC CAA GTA ATC C-3′, respectively. .. The full-length cpgh125 gene (locus tag CPE0426) was PCR amplified from C. perfringens ATCC 13124 genomic DNA using the following forward and reverse oligonucleotide primers, 5′-TAT ACC ATG GCC AGT TTA TCA ACT AAC GAA TT-3′ and 5′-GTG GTG CTC GAG TTT TTT ATT TAT AAC TTT CTC-3′, respectively.

Review